Infectious mononucleosis and herpes 6 types..

[15]

Doctors! The subject is not enough issledovanaja on mine who would be desirable to learn or find out than diagnoses. (ptsr, ifa, rnif) and it is how much authentic, who than treats, what forecast and reference at extract (convalescence) of complication, way of transfer! It is a lot of questions which parents set and it would be desirable to give answers to them and to itself

[souldna]

Here the information on an infectious mononucleosis:

http: // www.herpes.ru/her/pat/eb/index.htm

Here about a pseudorubella: http: // www.herpes.ru/her/pat/hhv6/index.htm

[nik.]

Here the information on an infectious mononucleosis:

http: // www.herpes.ru/her/pat/eb/index.htm

Here about a pseudorubella: http: // www.herpes.ru/her/pat/hhv6/index.htm



Jedi ivkoko!



Find for the doctor-pediatrist more serious links.



You the expert on gerpesvirusam!

[Sergej35]

Yes that that at you on saite is absolutely not enough me:o besides I asked the information on a mononucleosis which not a -bar and not TSMV namely herpes 6 types!

[Victoria]

HUMAN HERPESVIRUS TYPE 6



Essentials of Diagnosis



Infant with high fever for several days; maculopapular rash after defervescence



Can be isolated in cultures of monocytes but takes 10-30 days and may be false negative



Detection of specific IgG and IgM by indirect immunofluorescence are diagnostic tests of choice



Blood or saliva PCR for HHV-6 DNA may be positive, but diagnostic significance uncertain due to intermittent excretion in asymptomatic patients



PCR positively in CSF diagnostic of encephalitis



General Considerations



In 1986 a human herpesvirus, now called human herpesvirus type 6 (HHV-6), was identified in cultures of peripheral blood lymphocytes from patients with lymphoproliferative diseases (Box 33-12). The virus, which is genetically distinct but morphologically similar to other herpesviruses, replicates in lymphoid tissue, especially CD4 + T lymphocytes, and has two distinct variants, A and B.



Initially it was thought that HHV-6 would grow only in freshly isolated B-lymphocytes, and the virus was referred to as the human B-lymphotropic virus (HBLV); now it is clear that the virus is preferentially tropic for CD4 + T lymphocytes. HHV-6 establishes a latent infection in T cells but may be activated to a productive lytic infection by mitogenic stimulation. Resting lymphocytes and lymphocytes from healthy immune individuals are resistant to HHV-6 infection. In vivo, HHV6 replication is controlled by cell-mediated immune factors. It appears to be capable of reactivating in immunosuppressed patients, but its clinical significance in this situation is unknown.



Serologic studies indicate that almost all children are infected by age 2. This makes HHV-6 the most communicable of all human herpesviruses. Most adults shed HHV-6 in saliva, and close personal contact is the most likely route of spread; vertical transmission also occurs.



Clinical Findings



Exanthem subitum occurs in infants and is characterized by fever, eg, 39 C for several days followed by defervescence and a light maculopapular rash spreading from the trunk to the extremities. CNS complications may occur with febrile seizures, meningitis and encephalitis. HHV-6 may also be a cause of febrile episodes in transplant recipients.



Diagnosis



Virus infection is best documented by seroconversion. Active virus infection can be documented by culture, antigenemia, or DNAemia, but since reactivation or is common, it is very difficult to use these tools to diagnose HHV-6 as the cause of disease. Also, culture takes 10-30 days.



Treatment



HHV-6 appears to be susceptible in vitro to ganciclovir and foscarnet and less susceptible to acyclovir, but no clinical data are available.



Prevention *amp; Control



Because HHV-6 infection is ubiquitous and almost all infants excrete the virus by 2 years of age, no preventative measure is practical. No vaccine is in development, and isolation is not practical owing to ubiquitous infection.

[vata]

Yes that that at you on saite is absolutely not enough me:o besides I asked the information on a mononucleosis which not a -bar and not TSMV namely herpes 6 types!



The mononucleosis (that means rising monocytes and mononuklearov in a blood) happens infectious (caused or called Epstein-Barra by virus or illness or disease Filatova) and not infectious (at diseases of a blood - leukoses)



And is still mononukleoznye signs at gerpesvirusah (TSMV) and some infectious diseases - - the mononucleosis at them is not present a hematological attribute, the clinical picture (a lymphadenitis, an angina, a nasopharyngitis, augmentation of a liver and a lien i.t.d is similar.)



At a sudden exanthema (gerpesvirus 6), the citation about which has resulted or brought jedi Dr. Is not present a hematological attribute - a mononucleosis, mononukleoznyh signs.

[gsa2279@mail.ru]

Anybody is a pity that to me so anything and has not told or said explanatory or sensible:o

[natabal]

Anybody is a pity that to me so anything and has not told or said explanatory or sensible:o

Exists *quot; International herpes management forum*quot;.

www.ihmf.org

http: // www.ihmf.org/library/down_m3.asp

http: // www.emedicine.com/med/topic1035.htm

There is a magazine *quot; Herpes*quot;. There are reviews which are easy for finding in pabmede. Esteem reviews of Dr. Stephen Dewhurst.

P.S. And so, our -lord, is absolutely right: the infectious mononucleosis is caused or causes not by herpes of 6-th type, and Epstein-Barra virus.

[Irina And.]

Exists *quot; International herpes management forum*quot;.

www.ihmf.org

http: // www.ihmf.org/library/down_m3.asp

http: // www.emedicine.com/med/topic1035.htm

There is a magazine *quot; Herpes*quot;. There are reviews which are easy for finding in pabmede. Esteem reviews of Dr. Stephen Dewhurst.

P.S. And so, our -lord, is absolutely right: the infectious mononucleosis is caused or causes not by herpes of 6-th type, and Epstein-Barra virus.

Thanks for references)):)

Just the infectious mononucleosis is caused or causes Epstein-Barra by virus and also a cytomegalovirus and a virus of herpes 6 types I work in unit where such patients full! I can even send photos the child of 2 years literally one of these days have started to treat ampitsilinom (houses) well and understand in what is it has poured out, have revealed herpes 6 types mononukleary in a blood all clinic but EBar has not come to light:D)







http: // www.emedicine.com/med/topic1035.htm

The acute infection in immunocompetent adults is rare, but can present as mononucleosislike illness or disease with a fever, a hyperadenosis, a hepatitis or encephalitis, and negative test results for CMV or virus Epshtejnovskogo barristera (EBV.) (translation or transfer promt:D)

[Andrej]

The review on HHV6

http: // www.cdc.gov/ncidod/eid/vol5no3/campadelli.htm

mononukleary too enter into a picture of an infection

[loli]

Thanks for references)):)

Just the infectious mononucleosis is caused or causes Epstein-Barra by virus and also a cytomegalovirus and a virus of herpes 6 types I work in unit where such patients full! I can even send photos the child of 2 years literally one of these days have started to treat ampitsilinom (houses) well and understand in what is it has poured out, have revealed herpes 6 types mononukleary in a blood all clinic but EBar has not come to light:D)







http: // www.emedicine.com/med/topic1035.htm

The acute infection in immunocompetent adults is rare, but can present as mononucleosislike illness or disease with a fever, a hyperadenosis, a hepatitis or encephalitis, and negative test results for CMV or virus Epshtejnovskogo barristera (EBV.) (translation or transfer promt:D)



Chocolate and shokoladnopodobnaja a sweet = a mononucleosis and mononukleoznopodobnye signs (for an explanation to parents)



Though who knows it or him, gerpesvirusy completely not studied or investigated problem and treatments, hypotheses, versions full.

[Ash]

Thanks for references)):)

Just the infectious mononucleosis is caused or causes Epstein-Barra by virus and also a cytomegalovirus and a virus of herpes 6 types I work in unit where such patients full! I can even send photos

Counter question - *quot; And what they in unit do or make? What for are hospitalized? *quot;

----------------------------------------------

Clause or Article for you though and not new, but quite useful (http: // content.nejm.org/cgi/content/full/329/3/168) - I I do not know, whether is at you access, therefore I result or bring the text-



Severe Infectious Mononucleosis-like Syndrome and Primary Human Herpesvirus 6 Infection in an Adult



Koichi Akashi, Yoshito Eizuru, Yoshiaki Sumiyoshi, Toshio Minematsu, Sachiko Hara, Mine Harada, Masahiro Kikuchi, Yoshiyuki Niho, and Yoichi Minamishima



Human herpesvirus 6 (HHV-6) was first isolated from patients with the acquired immunodeficiency syndrome or lymphoproliferative diseases and was named human B-lymphotropic virus1. However, later studies revealed that the virus is T-lymphotropic in vitro2 and in vivo3. Recently, two genotypes of HHV-6 (type A and type B) have been distinguished on the basis of their restriction polymorphism4,5,6. HHV-6 has been identified as the etiologic agent of exanthem subitum in infants, 7 and an acute febrile illness in young children8. Most people are seropositive for HHV-6 by the age of three years9,10.



HHV-6 also produces latent or chronic infections11,12,13 and is occasionally reactivated in immunocompromised hosts1,14,15,16. Furthermore, HHV-6 has been implicated in several diseases in immunocompetent adults, including Kikuchi's lymphadenitis17 and an infectious mononucleosis-like syndrome that is negative for Epstein-Barr virus and cytomegalovirus18,19,20,21.



We describe the immunopathological and virologic features of a severe infectious mononucleosis-like syndrome in a 43-year-old man that was probably caused by a primary infection with HHV-6 type B.



Case Report



A 43-year-old man was admitted to Harasanshin General Hospital on May 2, 1992, with a seven-day history of fever and a five-day history of progressive, generalized skin eruption. He had been healthy and had a history of self-limiting viral infections including measles and rubella in childhood. Physical examination revealed a high fever (temperature, 40.6 C), bilateral cervical lymphadenopathy, mild splenomegaly, and tonsillar pharyngitis with a white exudate. The skin was covered with erythematous macules and papules (Figure 1A). The hemoglobin level was 12.7 g per deciliter, the platelet count was 127 x 103 per cubic millimeter, and the white-cell count was 16.9 x 103 per cubic millimeter, with 58 percent atypical lymphocytes. Liver dysfunction was seen, with an increase in the levels of aspartate aminotransferase (64 IU per liter), alanine aminotransferase (98 IU per liter), and lactate dehydrogenase (1313 IU per liter). Serum immunoglobulin levels were normal, and no antibodies against human T-cell lymphotrophic virus type I and human immunodeficiency virus were detected. The heterophil antibody test was negative.



Figure 1. Physical and Immunohistochemical Findings in a 43-Year-Old Man.



There was generalized exanthem over the abdomen; the patient's body was covered with erythematous macules and papules (Panel A). Staining of a skin-biopsy specimen with hematoxylin and eosin revealed focal vacuolar degeneration of the basal layer of the epidermis, with occasional lymphoid cells, and a marked infiltration of lymphoid cells in the dermis (Panel B, x100). The infiltrating lymphocytes were positive for T11 (CD2) on immunohistochemical staining (Panel C, x140). They were also positive for OKT4 (CD4) and OKT8 (CD8) (data not shown), indicating that they consisted of both CD4 + T cells and CD8 + T cells. HHV-6 antigen staining of purified CD4 + T cells with OHV-2 antibody showed that 32 percent of the CD4 + T cells were positive for OHV-2 (Panel D, x950).





Within four days of hospitalization, there was a rapid increase in the white-cell count (to 31.0 x 103 per cubic millimeter), with 44 percent atypical lymphocytes, in association with high fevers, continued liver dysfunction (aspartate aminotransferase, 271 IU per liter; alanine aminotransferase, 391 IU per liter; and lactate dehydrogenase, 2067 IU per liter), and renal dysfunction (creatinine, 3.6 mg per deciliter [315 mol per liter]). The skin lesions coalesced, and diffuse erythema developed over the whole body. Methylprednisolone (250 mg per day) was administered for three days beginning on the seventh day of hospitalization. A decrease in atypical lymphocytes was noted. The skin eruption healed, with abundant membranous exfoliation, and the mononucleosis-like symptoms gradually disappeared. The patient was sent home on the 58th hospital day and had no clinical sequelae.



Methods



Phenotypic Analysis of Atypical Lymphocytes



Peripheral-blood mononuclear cells (PBMCs) were separated by Ficoll-Hypaque density-gradient centrifugation. Nonadherent PBMCs were phenotyped on a FACSort flow cytometer (Becton Dickinson, Mountain View, Calif.), with the use of fluorescein-or phycoerythrin-conjugated monoclonal antibodies, including T11 (CD2), Leu-4 (CD3), Leu-3a (CD4), Leu-9 (CD7), Leu-2a (CD8), Leu-11 (CD16), NKH-1 (CD56), anti-HLA-DR and MY10 (CD34) (all from Becton Dickinson), and J5 (CD10), MY7 (CD13), B4 (CD19), B1 (CD20), and MY9 (CD33) (all from Coulter Immunology, Hialeah, Fla.). Mouse IgG1 conjugated to fluorescein or phycoerythrin was used as a negative control. CD4 + or CD8 + lymphocytes were purified from nonadherent PBMCs on CD4-or CD8-conjugated immunomagnetic beads (Dynabeads M450; Dynal, Oslo, Norway).



Immunohistochemical Staining



A biopsy was performed on the sixth day of hospitalization, and skin was obtained from the forearm in an area with many erythematous papules and macules. Sections of the specimen were stained with the monoclonal antibodies mentioned above, according to the avidin-biotin-alkaline phosphatase method22.



Examination of Viral Antigen



Cytomegalovirus antigen was stained by the direct immunoperoxidase method with a horseradish peroxidase-conjugated human monoclonal antibody, HRP-C723. HHV-6 antigen was examined with an HHV-6-specific monoclonal antibody, OHV-2 (kindly provided by Dr. Yamanishi, Osaka University, Osaka, Japan), 24 according to the avidin-biotin-alkaline phosphatase method. OHV-2 can recognize both types of HHV-6.



Titration of Anti-HHV-6 Antibody



The patient's serum samples were cryopreserved at-80 C until use. Titration of anti-HHV-6 antibody was done by an indirect immunofluorescence assay in which MT-4 cells persistently infected with HHV-6 (HST strain) were used as a target antigen and fluorescein-conjugated antihuman IgG or IgM goat serum was used as a secondary antibody. To detect anti-HHV-6 IgM, serum IgG and IgA were absorbed by G186 and AR1, respectively25. These samples were handled simultaneously. Serum obtained from a patient with active exanthem subitum was used as a positive control.



Examination of Herpesvirus DNA by the Polymerase Chain Reaction



Herpesvirus DNA was detected by the polymerase-chain-reaction (PCR) method. The following primers were used: for amplification of HHV-6 DNA, 5'CCCATTTACGATTTCCTGCACCACCTCTCTGC3 ' and 5'TTCAGGGACCGTTATGTCATTGAGCATGTC3 ' (the large-segment protein-gene region); for cytomegalovirus, 5'GCAGAGCTCGTTTAGTGAACC3 ' and 5'GGCACGGGGAATCCGCGTTCC3 ' (the major immediate early region); for Epstein-Barr virus, 5 ' CCAGAGGTAAGTGGACTT3 ' and 5'GACCGGTGCCTTCTTAGG3 ' (the long-internal-reiteration region); and for herpes simplex virus, 5'CATCACCGACCCGGAGAGGGAC3 ' and 5'GGGCCAGGCGCTTCTTGGTGTA3 ' (the DNA polymerase region).



Genotyping of HHV-6



Genotyping of HHV-6 was carried out according to Aubin et al5. HHV-6 DNA was amplified with primers 5'GATCCGACGCCTACAAACAC3 ' and 5'CGGTGTCACACAGCATGAACTCTC3 '. The expected PCR product of 830 base pairs (bp) corresponds to the pHC5 insert of HHV-6. The PCR product was digested with HindIII and then subjected to electrophoresis on a 3 percent agarose gel. After the bands were stained with ethidium bromide, the electrophoretic pattern was photographed under ultraviolet light. PCR products from HHV-6 type B are digested into 610-bp and 220-bp fragments, whereas those from type A HHV-6 are not5.

[Maria valerevn]

Results



The majority of the population of PBMCs on the sixth day of hospitalization consisted of CD4 + and CD8 + T cells. The cells were positive for CD2 (91.6 percent), CD3 (88.1 percent), CD4 (35.7 percent), CD7 (77.2 percent), CD8 (52.6 percent), and HLA-DR (79.0 percent), whereas they were negative for CD10 (0 percent), CD13 (0.4 percent), CD16 (1.4 percent), CD19 (0.8 percent), CD20 (0.6 percent), CD33 (2 percent), CD34 (0 percent), and CD56 (1.9 percent). T cells positive for CD4 and CD8 were not detected by CD4/CD8 two-color analysis.



The skin biopsy revealed a diffuse infiltration of atypical lymphoid cells in the dermis. The epidermis was nearly intact except for focal vacuolar degeneration of the basal layer (Figure 1B). The infiltrating lymphocytes were positive for CD2 (Figure 1C), CD3, CD4, and CD8, but negative for CD19 and CD20.



Table 1 shows the serial changes in titers of antibody against herpesviruses. Anti-HHV-6 IgG could not be detected 13 days after the onset of disease (hospital day 6), but it was detected on day 24 of the illness (hospital day 17) and reached its peak on day 74 (hospital day 67). IgG antibodies against cytomegalovirus, Epstein-Barr virus, and herpes simplex virus were detected, but their titers did not change significantly during the course of the illness.



Table 1. Antibody Titers and Viral DNA in the Patient's Serum.





Immunohistochemical staining with OHV-2 was performed on CD4 + and CD8 + T cells collected on the sixth day of hospitalization. Thirty-two percent of the CD4 + T cells were positive for the HHV-6 antigen (Figure 1D), whereas CD8 + T cells were negative for the antigen (*lt; 1 percent). Cytomegalovirus-infected cells were not observed in the nucleated blood cells (0 per 26,000 cells).



HHV-6 DNA was detected by PCR in serum collected on days 10 and 13 of the patient's illness, indicating the presence of HHV-6 viremia (Table 1); other types of herpesvirus DNA were not detected. HHV-6 DNA was also amplified by PCR in nonadherent PBMCs, CD4 + T cells, and a skin-biopsy specimen (data not shown). Digestion of the 830-bp PCR product with HindIII produced two fragments of 610 bp and 220 bp, indicating a type B genotype (Figure 2).



Figure 2. Genotypic Analysis of HHV-6 DNA Amplified by PCR.



The 830-bp PCR product was amplified in nonadherent PBMCs and CD4 + T cells. The digestion of the 830-bp band with HindIII produced two fragments of 610 bp and 220 bp, indicating an HHV-6 type B genotype. DNA from MT-4 cells persistently infected with HHV-6 and uninfected MT-4 cells were used as positive and negative controls, respectively. The plus and minus symbols indicate the presence and absence of HindIII digestion, respectively.





Discussion



Our 43-year-old patient with a severe mononucleosis-like syndrome had seroconversion of serum anti-HHV-6 IgG; HHV-6-specific DNA sequence was detected in serum, nonadherent PBMCs, CD4 + T cells, and a skin-biopsy specimen. In healthy adults who are positive for anti-HHV-6 IgG, latent HHV-6 DNA has sometimes been undetectable by PCR in serum and nonadherent PBMCs, because HHV-6 latently infects blood monocytes11. Our data indicate that HHV-6 was the cause of our patient's acute illness. Serologic and PCR studies excluded the possibility of active infection by other human herpesviruses. The cytomegalovirus antigen was not detected in nucleated blood cells. Accordingly, the increase in the HHV-6 IgG titer was not the result of serologic cross-reactions between HHV-6 and cytomegalovirus, 26 or of the reactivation of HHV-6 induced by active infections with cytomegalovirus or Epstein-Barr virus27,28,29.



Since the anti-HHV-6 IgG titer declines with age, 30 it may remain undetected in some adult carriers of HHV-6. It took more than 13 days for anti-HHV-6 IgG to become detectable in our patient. Accordingly, we believe that this episode was due to a primary HHV-6 infection, though anti-HHV-6 IgM could not be detected. The administration of methylprednisolone beginning on hospital day 7 may have suppressed the increase in serum anti-HHV-6 IgM so that it remained below detectable levels. Alternatively, infection of CD4 + T cells with HHV-6 may have impaired the production of anti-HHV-6 IgM.



All the viral strains isolated from children with exanthem subitum were of the type B genotype, 5,6,8 whereas HHV-6 type A was isolated most commonly from immunocompromised adults5. The causative HHV-6 in this patient was type B. Skin lesions were striking and severe and did not resemble exanthem subitum. The skin lesions were characterized by an aggressive infiltration of both CD4 + and CD8 + T-cell populations into the dermis. The pathogenesis of the skin rash in exanthem subitum is not well known. The type B genotype could not be regarded as a molecular marker of the pathogenicity of skin involvement in children, because most strains isolated from children with acute febrile illnesses who do not have exanthem are also type B4.



HHV-6 preferentially infects CD4 + T cells in vitro2,6. In exanthem subitum, HHV-6 has been shown to infect CD4 + T cells in vivo3. In our patient, the main target of HHV-6 was also CD4 + T cells. CD4 +/CD8 + T cells did not appear in the blood, though the induction of CD4 molecules in CD4-/CD8 + T cells by HHV-631 has been reported. There were too few B cells to analyze. On the basis of these data, the mechanism of infectious mononucleosis-like illness in this patient might be the unregulated proliferative response of CD8 + T cells against CD4 + T cells infected with HHV-6. This possibility is quite interesting, because in infectious mononucleosis related to Epstein-Barr virus, there is a proliferative response of CD8 + T cells against B cells infected with the virus.



Thus, in addition to causing exanthem subitum in infants and a febrile illness in children, HHV-6 type B can cause a severe infectious mononucleosis-like syndrome in adults.



Supported in part by grants-in-aid from the Fukuoka Cancer Society (1991) and the Japanese Society for the Promotion of Science for Japanese Junior Scientists (05-1238).



We are indebted to Dr. Shuhei Imayama, Department of Dermatology, Faculty of Medicine, Kyushu University, for helpful discussion.





Source Information



From the Departments of Hematology (K.A.) and Dermatology (S.H.), Harasanshin General Hospital, Fukuoka, Japan; the Department of Microbiology, Miyazaki Medical College, Miyazaki, Japan (Y.E., T.M., Y.M.); the First Department of Pathology, School of Medicine, Fukuoka University, Fukuoka, Japan (Y.S., M.K.); and the First Department of Internal Medicine, Kyushu University, Fukuoka, Japan (M.H., Y.N.).



Address reprint requests to Dr. Akashi at the Department of Hematology, Harasanshin General Hospital, 1-8 Taihaku-machi, Hakata-ku, Fukuoka 812, Japan.

[nursetanya]

The citation ---the Counter question - *quot; And what they in unit do or make? What for are hospitalized? *quot; Alon





Eruptions as toksikodermii at home), scurfs, and age till 2th years are hospitalized in occasion of a fever! Though more than half of patients in hospitals it is possible to address a question on expediency of hospitalization to doctors fast which carry all successively and to doctors of a reception which them accept! And that we need to do or make to treat for MESov by that that is)

[Irinka]

For the sake of interest and how have defined or determined type of a virus and in what liquid (a saliva, a blood, plasma i.t.d)? Well a method what however?:)

[memphis]

By birth took PTSR and IFA to Ig M, G there is eshe RNIF a technique new to us but yet did not send anybody

[rain]

PCR and IFA it is quite enough